Details for miRNA: hsa-miR-224-5p


Mature ID
hsa-miR-224-5p
Expression in EYE
33.3102 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-224
Pre-Mature Accession
MI0000301    (more details)
family
MIPF0000088
chromosome
X
Pre-Mature Location
-151127050
Gene Targets
ATP2B1 / MYH9 / SLC33A1 / CASP3 / SOD1 / THBS1 / ZNF644 / LRPAP1 / P3H2 / DCN / NRAS / CDK4 / MITF / SF3B1 / GNAQ / IGF1R / GNA11 / EIF1AX / CTH / RB1 / MDM2 / E2F1 / GCNT2 / AGK / BICD2 / TMCO1 / MMP1 / SQSTM1 / RP2 / IMPG2 / KIAA1549 / SLC7A14 / SLC37A3 / EYS / COL4A1 / UBA5 / GDAP2 / VPS41 / CLCC1 / KIF3B / RDH11 /
sequence
UCAAGUCACUAGUGGUUCCGUUUAG

Back to List