Details for miRNA: hsa-miR-140-3p


Mature ID
hsa-miR-140-3p
Expression in EYE
779.3088 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-140
Pre-Mature Accession
MI0000456    (more details)
family
MIPF0000085
chromosome
16
Pre-Mature Location
69966984
Gene Targets
PAX6 / SOD1 / ZNF644 / LRPAP1 / DCN / PTEN / MAX / E2F1 / NHS / NR3C1 / IMPDH1 / USH2A / ARL2BP / ZNF408 / SLC37A3 / COL4A1 /
sequence
UACCACAGGGUAGAACCACGG

Back to List