Details for miRNA: hsa-miR-200a-5p


Mature ID
hsa-miR-200a-5p
Expression in EYE
14.0094 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-200a
Pre-Mature Accession
MI0000737    (more details)
family
MIPF0000019
chromosome
1
Pre-Mature Location
1103243
Gene Targets
ATP2B1 / CASP3 / PTEN / MDM4 / MBP / FOXC1 / PRPF4 / MERTK /
sequence
CAUCUUACCGGACAGUGCUGGA

Back to List