Details for miRNA: hsa-miR-342-3p


Mature ID
hsa-miR-342-3p
Expression in EYE
685.7862 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-342
Pre-Mature Accession
MI0000805    (more details)
family
MIPF0000190
chromosome
14
Pre-Mature Location
100575992
Gene Targets
ATM / PAX6 / THBS1 / LRPAP1 / IGF1R / MDM2 / MAX / E2F1 / CYP1B1 / MBP / FNDC3B / IDH3B / SNRNP200 / ZNF408 / TPP1 / ATG5 / HK1 /
sequence
UCUCACACAGAAAUCGCACCCGU

Back to List