Details for miRNA: hsa-miR-28-5p


Mature ID
hsa-miR-28-5p
Expression in EYE
190.0872 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-28
Pre-Mature Accession
MI0000086    (more details)
family
MIPF0000057
chromosome
3
Pre-Mature Location
188406569
Gene Targets
PAX6 / ACE / CDK4 / PTEN / TP53 / IGF1R / NF1 / KIF1B / TMEM127 / BCOR / DNMBP / CYP1B1 / MYLK / TP53BP2 / IMPDH1 / TUB / PITRM1 / COA7 /
sequence
AAGGAGCUCACAGUCUAUUGAG

Back to List