Details for miRNA: hsa-miR-1914-3p


Mature ID
hsa-miR-1914-3p
Expression in EYE
0.0102 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-1914
Pre-Mature Accession
MI0008335    (more details)
family
MIPF0001040
chromosome
20
Pre-Mature Location
-62572818
Gene Targets
MYH9 / INTS1 / KCNQ5 / BAP1 / PLCB4 / TMEM127 / BCOR / FYCO1 / AGK / AGPAT1 / NECTIN1 / BBS2 / KIF3B /
sequence
GGAGGGGUCCCGCACUGGGAGG

Back to List