Details for miRNA: hsa-miR-4676-5p


Mature ID
hsa-miR-4676-5p
Expression in EYE
0.0286 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-4676
Pre-Mature Accession
MI0017307    (more details)
family
chromosome
10
Pre-Mature Location
74480787
Gene Targets
PITX3 / PRPF8 /
sequence
GAGCCAGUGGUGAGACAGUGA

Back to List