Details for miRNA: hsa-miR-151a-5p


Mature ID
hsa-miR-151a-5p
Expression in EYE
2651.1674 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-151a
Pre-Mature Accession
MI0000809    (more details)
family
MIPF0000057
chromosome
8
Pre-Mature Location
-141742663
Gene Targets
BMP2 / PTEN / TP53 / POT1 / GNAQ / CDH11 / BCOR / BICD2 / SNRNP200 / ZNF469 /
sequence
UCGAGGAGCUCACAGUCUAGU

Back to List