Details for miRNA: hsa-miR-335-5p


Mature ID
hsa-miR-335-5p
Expression in EYE
265.7294 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-335
Pre-Mature Accession
MI0000816    (more details)
family
MIPF0000196
chromosome
7
Pre-Mature Location
130135952
Gene Targets
DHCR7 / SC5D / SLC33A1 / VEGFA / ACE / ZNF644 / BMP2 / SIX6 / RDH5 / MTHFR / TERT / IGF1R / CTH / NDP / RB1 / MDM4 / MDM2 / CDH11 / TMEM127 / CFTR / SLC22A18 / GJA8 / CRYGC / CRYBA1 / BFSP2 / GCNT2 / LIM2 / CRYGS / TDRD7 / CRYBA2 / LSS / DNMBP / OPTN / LTBP2 / LRP5 / LOXL1 / GFAP / TGFB2 / CPAMD8 / PTGS2 / FNDC3B / DDIT3 / EFNA5 / ICAM1 / TLR4 / ABCA4 / CFB / C2 / CFH / CFHR1 / CFHR2 / HIC1 / CFI / HTRA1 / TIMP3 / SQSTM1 / FBLN5 / HMCN1 / FOXO1 / NECTIN2 / CNGB1 / PDE6G / RP1 / RPE65 / SAG / USH2A / LRAT / MERTK / ATF6 / FSCN2 / CST3 / MAFB / SETX / SYT14 / SPTBN2 / RP1L1 /
sequence
UCAAGAGCAAUAACGAAAAAUGU

Back to List