Details for miRNA: hsa-miR-197-5p


Mature ID
hsa-miR-197-5p
Expression in EYE
0.5912 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-197
Pre-Mature Accession
MI0000239    (more details)
family
MIPF0000123
chromosome
1
Pre-Mature Location
110141515
Gene Targets
BBS1 /
sequence
CGGGUAGAGAGGGCAGUGGGAGG

Back to List