Details for miRNA: hsa-miR-3180-3p


Mature ID
hsa-miR-3180-3p
Expression in EYE
0.436 (RPM)
Mature Accession
 
Pre-Mature ID
Pre-Mature Accession
MIMAT0015058    (more details)
family
chromosome
Pre-Mature Location
Gene Targets
MYH9 / SLC33A1 / XRCC3 / STK11 / IGF1R / FASN / PITX3 / TULP1 /
sequence
UGGGGCGGAGCUUCCGGAGGCC

Back to List