Details for miRNA: hsa-miR-126-3p


Mature ID
hsa-miR-126-3p
Expression in EYE
494.5936 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-126
Pre-Mature Accession
MI0000471    (more details)
family
MIPF0000115
chromosome
9
Pre-Mature Location
139565054
Gene Targets
SLC2A1 / VEGFA / CASP3 / THBS1 / SIRT1 / BMP4 / PTEN / STK11 / IGF1R / CYSLTR2 / NF1 / RB1 / KIF14 / RASSF1 / MAX / E2F1 / CRYBA4 / VIM / CRYBA2 / CYP1B1 / SIL1 / TEK / CFH / RPGR / SQSTM1 / PARP12 / HMCN1 / NEK2 / CLRN1 / PROM1 / MERTK / PDAP1 / SLC7A14 / CYP4V2 / SLC4A11 / HLA-DRB4 / SCYL1 / TDP1 /
sequence
UCGUACCGUGAGUAAUAAUGCG

Back to List