Details for miRNA: hsa-miR-590-3p


Mature ID
hsa-miR-590-3p
Expression in EYE
4.5954 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-590
Pre-Mature Accession
MI0003602    (more details)
family
MIPF0000418
chromosome
7
Pre-Mature Location
73605528
Gene Targets
ATP2B1 / VEGFA / CASP3 / PRIMPOL / TBK1 / STK11 / GNAQ / IGF1R / JMJD6 / NF1 / MDM2 / BCOR / NHS / WDR36 / RBMS3 / POMP / FOXC1 / TMCO1 / FNDC3B / NR3C1 / NMNAT1 / PRPF4 / FLVCR1 / FAM161A / COL4A1 / SETX / THG1L / CLCC1 / RDH11 /
sequence
UAAUUUUAUGUAUAAGCUAGU

Back to List