Details for miRNA: hsa-miR-6875-3p


Mature ID
hsa-miR-6875-3p
Expression in EYE
0.0698 (RPM)
Mature Accession
 
Pre-Mature ID
Pre-Mature Accession
MIMAT0027651    (more details)
family
chromosome
Pre-Mature Location
Gene Targets
SC5D / SIX6 / SSTR2 / EIF1AX / SDHD / HLA-DRB1 / TMCO1 / ARL3 /
sequence
AUUCUUCCUGCCCUGGCUCCAU

Back to List