Details for miRNA: hsa-miR-6811-5p


Mature ID
hsa-miR-6811-5p
Expression in EYE
0.1382 (RPM)
Mature Accession
 
Pre-Mature ID
Pre-Mature Accession
MIMAT0027522    (more details)
family
chromosome
Pre-Mature Location
Gene Targets
SIX6 /
sequence
AUGCAGGCCUGUGUACAGCACU

Back to List