Details for miRNA: hsa-miR-6895-3p


Mature ID
hsa-miR-6895-3p
Expression in EYE
0.15 (RPM)
Mature Accession
 
Pre-Mature ID
Pre-Mature Accession
MIMAT0027691    (more details)
family
chromosome
Pre-Mature Location
Gene Targets
SIX6 / GJD2 / UNC45B /
sequence
UGUCUCUCGCCCUUGGCCUUAG

Back to List