Details for miRNA: hsa-miR-1229-5p


Mature ID
hsa-miR-1229-5p
Expression in EYE
0.01 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-1229
Pre-Mature Accession
MI0006319    (more details)
family
chromosome
5
Pre-Mature Location
-179225278
Gene Targets
BBS1 /
sequence
GUGGGUAGGGUUUGGGGGAGAGCG

Back to List