Details for miRNA: hsa-miR-129-2-3p


Mature ID
hsa-miR-129-2-3p
Expression in EYE
79.8688 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-129-2
Pre-Mature Accession
MI0000473    (more details)
family
MIPF0000073
chromosome
11
Pre-Mature Location
43602944
Gene Targets
AKR1B1 / ATP2B1 / MYH9 / PAX6 / SC5D / SLC2A1 / AGT / AGTR1 / CASP3 / THBS1 / LRPAP1 / BMP2 / IRX5 / KCNQ5 / MTHFR / TBK1 / DCN / BMP4 / GREM1 / NRAS / MITF / PTEN / POT1 / TERT / BAP1 / HLA-G / GNAQ / IGF1R / SSTR2 / PLCB4 / CTH / NDP / MDM2 / KIF14 / KIF1B / TMEM127 / RASSF1 / RET / SLC22A18 / MAX / BCR / CHEK2 / BCOR / CAPN5 / STAT4 / CRYBB2 / EPHA2 / GCNT2 / TDRD7 / NHS / LSS / DNMBP / WDR36 / LTBP2 / LOXL1 / RBMS3 / TLCD5 / SIL1 / BICD2 / CDKN2B / MYLK / TGFB2 / SLC4A4 / TEK / CAV2 / PTGS2 / DDIT3 / EFNA5 / GLCC / AHR / FAS / ICAM1 / TLR4 / C3 / CFH / CFI / HTRA1 / RPGR / TNFRSF10A / SQSTM1 / FBLN5 / CFHR4 / PARP12 / HMCN1 / PTPN22 / CYP2R1 / NECTIN2 / CLN3 / CNGA1 / NEK2 / PDE6A / PRPF3 / MERTK / PDAP1 / FSCN2 / ABHD12 / AHI1 / SPATA7 / KLHL7 / PRTFDC1 / SLC7A14 / AGBL5 / ARL6 / FAM161A / CYP4V2 / CERKL / COL4A1 / TGFBI / CST3 / MAFB / ZNF469 / SYNE1 / GRM1 / SPTBN2 / SLC9A1 / ATG7 / HK1 /
sequence
AAGCCCUUACCCCAAAAAGCAU

Back to List