Details for miRNA: hsa-miR-6870-3p


Mature ID
hsa-miR-6870-3p
Expression in EYE
0.0056 (RPM)
Mature Accession
 
Pre-Mature ID
Pre-Mature Accession
MIMAT0027641    (more details)
family
chromosome
Pre-Mature Location
Gene Targets
SLC2A1 / VEGFA / SIX6 /
sequence
GCUCAUCCCCAUCUCCUUUCAG

Back to List