Details for miRNA: hsa-miR-130a-3p


Mature ID
hsa-miR-130a-3p
Expression in EYE
723.372 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-130a
Pre-Mature Accession
MI0000448    (more details)
family
MIPF0000034
chromosome
11
Pre-Mature Location
57408671
Gene Targets
ATM / INTS1 / P3H2 / KCNQ5 / TNF / LMX1B / BRAF / NRAS / CDK4 / PTEN / SSTR2 / CTH / RB1 / MDM4 / KIF14 / KIF1B / VHL / FGFR1 / FASN / E2F1 / CHEK2 / EPHA2 / FYCO1 / TDRD7 / WDR36 / BICD2 / CAV2 / TMCO1 / FNDC3B / DDIT3 / NR3C1 / GLCC / FAS / SQSTM1 / PARP12 / HMCN1 / IMPDH1 / TUB / PRPF4 / PRPF8 / KIAA1549 / ZNF408 / HGSNAT / MAFB / VPS13D / TPP1 / THG1L / PITRM1 / RDH11 /
sequence
CAGUGCAAUGUUAAAAGGGCAU

Back to List