Details for miRNA: hsa-miR-664b-3p


Mature ID
hsa-miR-664b-3p
Expression in EYE
4.7274 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-664b
Pre-Mature Accession
MI0019134    (more details)
family
MIPF0000300
chromosome
X
Pre-Mature Location
153996871
Gene Targets
SIX6 / EIF1AX / PLCB4 / MDM2 / HLA-DRB1 / WDR36 /
sequence
UUCAUUUGCCUCCCAGCCUACA

Back to List