Details for miRNA: hsa-miR-9-5p


Mature ID
hsa-miR-9-5p
Expression in EYE
3525.806 (RPM)
Mature Accession
 
Pre-Mature ID
Pre-Mature Accession
MIMAT0000441    (more details)
family
chromosome
Pre-Mature Location
Gene Targets
ATM / MYH9 / VEGFA / SIRT1 / P4HA2 / COL9A1 / MITF / TP53 / AIMP1 / GNAQ / PLCB4 / NF1 / FGF2 / MDM4 / MDM2 / KIF1B / BCOR / FYCO1 / VIM / LEMD2 / AQP4 / OPTN / CYP1B1 / LRP5 / MBP / MYLK / FOXC1 / PTGS2 / FNDC3B / FAS / FOXO1 / CHM / IDH3A / RP2 / PRPF4 / ATF6 / FLVCR1 / AHI1 / TGFBI / ZNF469 / SETX / PMPCA / SYNE1 / ATG5 /
sequence
UCUUUGGUUAUCUAGCUGUAUGA

Back to List