Details for miRNA: hsa-let-7e-5p


Mature ID
hsa-let-7e-5p
Expression in EYE
3790.2074 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-let-7e
Pre-Mature Accession
MI0000066    (more details)
family
MIPF0000002
chromosome
19
Pre-Mature Location
52196039
Gene Targets
DHCR7 / MYH9 / CASP3 / THBS1 / ZNF644 / P4HA2 / BMP2 / TBK1 / BMP4 / NRAS / CDK4 / PTEN / TP53 / IGF1R / NF1 / RB1 / MDM4 / MDM2 / KIF1B / HDAC2 / FGFR1 / FASN / BCOR / GCNT2 / VIM / TDRD7 / INPP5K / SIL1 / PTGS2 / ATXN2 / FNDC3B / AHR / FAS / TIMP3 / NMNAT1 / CYP2R1 / FOXO1 / CHM / CRX / IMPDH1 / PRPF8 / SNRNP200 / PRPF31 / KIAA1549 / COL4A1 / PRDM5 / PMPCA / VPS13D / TPP1 / SYNE1 / SPTBN2 / SCYL1 / THG1L / TDP1 / COA7 / YAP1 /
sequence
UGAGGUAGGAGGUUGUAUAGUU

Back to List