Details for miRNA: hsa-miR-429


Mature ID
hsa-miR-429
Expression in EYE
100.5032 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-429
Pre-Mature Accession
MI0001641    (more details)
family
MIPF0000019
chromosome
1
Pre-Mature Location
1104385
Gene Targets
ALDH3A1 / SLC2A1 / PISD / VEGFA / CASP3 / SIRT1 / TBK1 / GREM1 / PTEN / BAP1 / EIF1AX / PLCB4 / CTH / TMEM127 / RET / BCOR / EPHA2 / WFS1 / CYP1B1 / CDKN2B / SLC4A4 / CAV1 / CAV2 / NR3C1 / MMP1 / AHR / C3 / SQSTM1 / BBS2 / CNGA1 / AHI1 / KIZ / COL4A1 / TGFBI / SLC4A11 / TUBA3D / ATG5 / CLCC1 / RDH11 /
sequence
UAAUACUGUCUGGUAAAACCGU

Back to List