Details for miRNA: hsa-miR-15b-5p


Mature ID
hsa-miR-15b-5p
Expression in EYE
133.5752 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-15b
Pre-Mature Accession
MI0000438    (more details)
family
MIPF0000006
chromosome
3
Pre-Mature Location
160122376
Gene Targets
ATP2B1 / PISD / VEGFA / AGT / P3H2 / MTHFR / CDK4 / STK11 / SF3B1 / GNAQ / IGF1R / EIF1AX / NF1 / FGF2 / MDM2 / KIF14 / KIF1B / TMEM127 / VHL / FGFR1 / MAX / APRT / FASN / FYCO1 / VIM / CHMP4B / AGK / UNC45B / SIPA1L3 / AGPAT1 / GFAP / MBP / FNDC3B / HTRA1 / TIMP3 / SQSTM1 / FOXO1 / NECTIN1 / PRPF8 / ATF6 / SNRNP200 / ARHGEF18 / HGSNAT / SETX / PMPCA / SPTBN2 / SLC9A1 / SCYL1 / HK1 / KIF3B / RDH11 / YAP1 /
sequence
UAGCAGCACAUCAUGGUUUACA

Back to List