Details for miRNA: hsa-let-7a-5p


Mature ID
hsa-let-7a-5p
Expression in EYE
32160.4734 (RPM)
Mature Accession
 
Pre-Mature ID
Pre-Mature Accession
MIMAT0000062    (more details)
family
chromosome
Pre-Mature Location
Gene Targets
ATP2B1 / MYH9 / SLC2A1 / INTS1 / ACE / CASP3 / THBS1 / ZNF644 / P4HA2 / CPSF1 / BMP2 / TBK1 / BMP4 / BRAF / NRAS / CDK4 / TP53 / SF3B1 / IGF1R / EIF1AX / PLCB4 / RB1 / MDM4 / MDM2 / CDH11 / HDAC2 / FGFR1 / MEN1 / MAX / E2F1 / BCOR / EPHA2 / GCNT2 / CYP1B1 / SIL1 / BICD2 / TEK / CAV1 / CAV2 / FOXC1 / PTGS2 / ATXN2 / FNDC3B / GLCC / AHR / FAS / TLR4 / HIC1 / NMNAT1 / CYP2R1 / FOXO1 / CRX / TUB / PRPF8 / SNRNP200 / ARL2BP / PRPF31 / KIAA1549 / SLC37A3 / COL4A1 / MAFB / PRDM5 / PMPCA / TPP1 / SYNE1 / SPTBN2 / SLC9A1 / SCYL1 / XRCC1 / GDAP2 / THG1L / COA7 / YAP1 /
sequence
UGAGGUAGUAGGUUGUAUAGUU

Back to List