Details for miRNA: hsa-miR-3619-5p


Mature ID
hsa-miR-3619-5p
Expression in EYE
0.0804 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-3619
Pre-Mature Accession
MI0016009    (more details)
family
chromosome
22
Pre-Mature Location
46486924
Gene Targets
ATP2B1 / INTS1 / LRPAP1 / BRAF / STK11 / SF3B1 / BAP1 / MDM2 / KIF1B / TMEM127 / FGFR1 / FASN / BCOR / CACNA1A / AGPAT1 / AHR / SQSTM1 / CLN3 / FOXI2 / CST3 / TPP1 /
sequence
UCAGCAGGCAGGCUGGUGCAGC

Back to List