Details for miRNA: hsa-miR-520f-3p


Mature ID
hsa-miR-520f-3p
Expression in EYE
0.0042 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-520f
Pre-Mature Accession
MI0003146    (more details)
family
MIPF0000020
chromosome
19
Pre-Mature Location
54185413
Gene Targets
PISD / COL9A1 / RDH5 / PLCB4 / KIF14 / FYCO1 / CYP1B1 / MMP1 / RPGRIP1 / TTC8 / TGFBI / ZNF469 /
sequence
AAGUGCUUCCUUUUAGAGGGUU

Back to List