Details for miRNA: hsa-miR-1226-5p


Mature ID
hsa-miR-1226-5p
Expression in EYE
0.426 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-1226
Pre-Mature Accession
MI0006313    (more details)
family
MIPF0000444
chromosome
3
Pre-Mature Location
47891045
Gene Targets
TMEM127 / FASN / AGK / AGPAT1 / ICAM1 / KIF3B /
sequence
GUGAGGGCAUGCAGGCCUGGAUGGGG

Back to List