Details for miRNA: hsa-miR-106b-5p


Mature ID
hsa-miR-106b-5p
Expression in EYE
35.4204 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-106b
Pre-Mature Accession
MI0000734    (more details)
family
MIPF0000001
chromosome
7
Pre-Mature Location
-99691616
Gene Targets
ATP2B1 / MYH9 / VEGFA / ZNF644 / LRPAP1 / BMP2 / BRAF / NRAS / PTEN / TP53 / STK11 / SF3B1 / IGF1R / CTH / FGF2 / RB1 / MDM4 / MDM2 / KIF14 / KIF1B / TMEM127 / VHL / E2F1 / BCOR / FYCO1 / WFS1 / AQP4 / WDR36 / BICD2 / SLC4A4 / CAV1 / FOXC1 / TXNRD2 / FNDC3B / NR3C1 / AHR / FAS / TNFRSF10A / SQSTM1 / RP2 / PRPF4 / TOPORS / ARHGEF18 / SPATA7 / KLHL7 / DHDDS / SETX / VPS13D / CWF19L1 / SLC9A1 /
sequence
UAAAGUGCUGACAGUGCAGAU

Back to List