Details for miRNA: hsa-miR-200a-3p


Mature ID
hsa-miR-200a-3p
Expression in EYE
157.5826 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-200a
Pre-Mature Accession
MI0000737    (more details)
family
MIPF0000019
chromosome
1
Pre-Mature Location
1103243
Gene Targets
VEGFA / THBS1 / PTEN / TP53 / SF3B1 / BAP1 / GNAQ / MDM4 / KIF1B / FGFR1 / BCOR / EPHA2 / CYP1B1 / BICD2 / TGFB2 / CAV2 / FOXC1 / NR3C1 / NECTIN1 / KIAA1549 / SETX / SYNE1 / YAP1 /
sequence
UAACACUGUCUGGUAACGAUGU

Back to List