Details for miRNA: hsa-miR-203a-3p


Mature ID
hsa-miR-203a-3p
Expression in EYE
1346.5646 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-203a
Pre-Mature Accession
MI0000283    (more details)
family
MIPF0000108
chromosome
14
Pre-Mature Location
104583742
Gene Targets
ALDH3A1 / ATM / ATP2B1 / DHCR7 / PAX6 / SLC33A1 / VEGFA / THBS1 / P3H2 / BMP2 / TNF / TBK1 / BMP4 / GREM1 / NRAS / PTEN / TP53 / POT1 / IGF1R / JMJD6 / CTH / FGF2 / RB1 / MDM2 / KIF14 / RASSF1 / CFTR / FGFR1 / SYK / E2F1 / EPHA2 / FYCO1 / VIM / PANK4 / WDR36 / LOXL1 / CAV1 / ATXN2 / DDIT3 / MMP1 / ICAM1 / TIMP3 / FBLN5 / FOXO1 / IDH3B / POMGNT1 / SEMA4A / CERKL / CST3 / MAFB / XRCC1 / COA7 / RDH11 / YAP1 /
sequence
GUGAAAUGUUUAGGACCACUAG

Back to List