Details for miRNA: hsa-let-7d-5p


Mature ID
hsa-let-7d-5p
Expression in EYE
1078.3154 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-let-7d
Pre-Mature Accession
MI0000065    (more details)
family
MIPF0000002
chromosome
9
Pre-Mature Location
96941116
Gene Targets
ATP2B1 / DHCR7 / GALK1 / PISD / CASP3 / GAD2 / THBS1 / ZNF644 / P4HA2 / CPSF1 / BRAF / NRAS / CDK4 / TP53 / BAP1 / IGF1R / NF1 / MDM4 / MDM2 / FGFR1 / MAX / FYCO1 / ATXN2 / GLCC / AHR / TLR4 / HIC1 / NECTIN2 / BBS2 / CLN3 / CRX / TOPORS / PRPF8 / SNRNP200 / ARL2BP / KIAA1549 / PRDM5 / PMPCA / SCYL1 / GDAP2 / THG1L / VPS41 / TDP1 / COA7 / SALL2 / YAP1 /
sequence
AGAGGUAGUAGGUUGCAUAGUU

Back to List