Details for miRNA: hsa-miR-181b-5p


Mature ID
hsa-miR-181b-5p
Expression in EYE
3069.8278 (RPM)
Mature Accession
 
Pre-Mature ID
Pre-Mature Accession
MIMAT0000257    (more details)
family
chromosome
Pre-Mature Location
Gene Targets
ATM / ATP2B1 / CASP3 / THBS1 / SIRT1 / PRSS56 / TBK1 / PTEN / IGF1R / NF1 / RB1 / MDM4 / KIF1B / TMEM127 / RASSF1 / FGFR1 / E2F1 / HLA-DRB1 / GCNT2 / FNDC3B / NR3C1 / TIMP3 / RP2 / MERTK / PRPF8 / ARL2BP / FLVCR1 / KLHL7 / SLC37A3 / HGSNAT / CLCC1 / KIF3B / YAP1 /
sequence
AACAUUCAUUGCUGUCGGUGGGU

Back to List