Details for miRNA: hsa-miR-101-3p


Mature ID
hsa-miR-101-3p
Expression in EYE
3335.0564 (RPM)
Mature Accession
 
Pre-Mature ID
Pre-Mature Accession
MIMAT0000099    (more details)
family
chromosome
Pre-Mature Location
Gene Targets
ATM / ATP2B1 / PITX2 / SC5D / PISD / VEGFA / CASP3 / SOD1 / THBS1 / BMP2 / RASGRF1 / RDH5 / KCNQ5 / NRAS / MITF / MC1R / BRD9 / GNAQ / IGF1R / SSTR2 / JMJD6 / CTH / NF1 / FGF2 / KIF1B / VHL / HDAC2 / CFTR / FASN / BCOR / EPHA2 / TDRD7 / WDR36 / CYP1B1 / LOXL1 / POMP / TLCD5 / INPP5K / SIL1 / BICD2 / SLC4A4 / PTGS2 / NR3C1 / MMP1 / FAS / CFH / TIMP3 / SQSTM1 / PTPN22 / NECTIN1 / NECTIN2 / IDH3A / RBP4 / USH2A / IFT88 / ARL2BP / FLVCR1 / COL4A1 / MAFB / SETX / SLC9A1 / THG1L / YAP1 /
sequence
UACAGUACUGUGAUAACUGAA

Back to List