Details for miRNA: hsa-miR-873-5p


Mature ID
hsa-miR-873-5p
Expression in EYE
18.2502 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-873
Pre-Mature Accession
MI0005564    (more details)
family
MIPF0000390
chromosome
9
Pre-Mature Location
-28888877
Gene Targets
PISD / VEGFA / SIRT1 / NRAS / POT1 / STK11 / NF1 / MDM2 / KIF1B / MAX / E2F1 / BCOR / CAPN5 / AGPAT1 / CAV1 / PDE6B / PRPF8 / PRPF6 / SCYL1 / VPS41 /
sequence
GCAGGAACUUGUGAGUCUCCU

Back to List