Details for miRNA: hsa-miR-135b-5p


Mature ID
hsa-miR-135b-5p
Expression in EYE
25.9152 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-135b
Pre-Mature Accession
MI0000810    (more details)
family
MIPF0000028
chromosome
1
Pre-Mature Location
-205417430
Gene Targets
THBS1 / KCNQ5 / MDM4 / MDM2 / NHS / SQSTM1 / FOXO1 / TUB / MERTK / MAFB / ATG5 /
sequence
UAUGGCUUUUCAUUCCUAUGUGA

Back to List