Details for miRNA: hsa-miR-1229-3p


Mature ID
hsa-miR-1229-3p
Expression in EYE
1.3764 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-1229
Pre-Mature Accession
MI0006319    (more details)
family
chromosome
5
Pre-Mature Location
-179225278
Gene Targets
CASP3 / SIRT1 / BAP1 / IGF1R / MDM2 / ACY1 / LRP5 / FNDC3B / SQSTM1 / NECTIN2 / SETX /
sequence
CUCUCACCACUGCCCUCCCACAG

Back to List