Details for miRNA: hsa-miR-5002-3p


Mature ID
hsa-miR-5002-3p
Expression in EYE
0.0164 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-5002
Pre-Mature Accession
MI0017868    (more details)
family
chromosome
3
Pre-Mature Location
123851776
Gene Targets
BBS1 / FLVCR1 /
sequence
UGACUGCCUCACUGACCACUU

Back to List