Details for miRNA: hsa-miR-147a


Mature ID
hsa-miR-147a
Expression in EYE
0.0014 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-147a
Pre-Mature Accession
MI0000262    (more details)
family
MIPF0000105
chromosome
9
Pre-Mature Location
-123007257
Gene Targets
AKR1B1 / ATP2B1 / DHCR7 / GALT / MYH9 / PAX6 / PITX2 / VEGFA / THBS1 / P3H2 / IRX5 / BRAF / CDK4 / MITF / PTEN / XRCC3 / BAP1 / AIMP1 / GNAQ / GNA11 / PLCB4 / CTH / FGF2 / KIF14 / KIF1B / LPA / SLC22A18 / SDHD / APRT / E2F1 / HSF4 / MAF / CRYBB3 / BFSP1 / TDRD7 / NHS / LSS / PANK4 / MYOC / OPTN / LTBP2 / CACNA1A / SIL1 / CDKN2A / TMCO1 / FNDC3B / TP53BP2 / DDIT3 / NR3C1 / SSNA1 / FAS / CFI / RLBP1 / RPGR / CFHR4 / NMNAT1 / CHM / NEK2 / PDE6A / RBP3 / RP9 / OFD1 / PROM1 / PDAP1 / ATF6 / AIPL1 / FLVCR1 / AHI1 / KIZ / KLHL7 / PRTFDC1 / RPGRIP1 / AGBL5 / ARL6 / FAM161A / TTC8 / SLC4A11 / CST3 / CHN1 / SETX / TPP1 / WWOX / SLC9A1 / XRCC1 / THG1L / COA7 / CLCC1 / IFT43 / RDH11 / HMX1 /
sequence
GUGUGUGGAAAUGCUUCUGC

Back to List