Details for miRNA: hsa-miR-23a-3p


Mature ID
hsa-miR-23a-3p
Expression in EYE
613.2568 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-23a
Pre-Mature Accession
MI0000079    (more details)
family
MIPF0000027
chromosome
19
Pre-Mature Location
-13947401
Gene Targets
MYH9 / SC5D / CASP3 / THBS1 / ZNF644 / KCNQ5 / BMP4 / PTEN / PLCB4 / JMJD6 / NF1 / RB1 / MDM2 / KIF1B / VHL / HDAC2 / SDHD / FASN / EPHA2 / AGK / SIPA1L3 / LEMD2 / DNMBP / AQP4 / LRP5 / BICD2 / OPA1 / FNDC3B / NR3C1 / GLCC / AHR / FAS / ABCA4 / HIC1 / HMCN1 / TOPORS / PRPF8 / SNRNP200 / FLVCR1 / AHI1 / KIZ / COL4A1 / SNX14 /
sequence
AUCACAUUGCCAGGGAUUUCC

Back to List