Details for miRNA: hsa-miR-130b-5p


Mature ID
hsa-miR-130b-5p
Expression in EYE
60.0122 (RPM)
Mature Accession
 
Pre-Mature ID
hsa-mir-130b
Pre-Mature Accession
MI0000748    (more details)
family
MIPF0000034
chromosome
22
Pre-Mature Location
22007593
Gene Targets
ATM / MYH9 / NDRG2 / SIX6 / GJD2 / SF3B1 / MDM4 / MDM2 / SDHD / FASN / AGPAT1 / TMCO1 / FNDC3B / NR3C1 / FOXO1 / PROM1 / PRPF8 / SCAPER / CST3 /
sequence
ACUCUUUCCCUGUUGCACUAC

Back to List